SARS-CoV-2 Genome Contains Mature miRNA Sequences That Can Interact Strongly With Human mRNA Genes

Running Title: SARS-CoV-2 miRNA’s and Human Genes

James P. Bennett, Jr.

Neurodegeneration Therapeutics, Inc.

Charlottesville, Virginia

Send Correspondence To:

James P. Bennett, Jr. M.D., Ph.D.

Neurodegeneration Therapeutics, Inc.

3050A Berkmar Drive

Charlottesville, VA 22901

PH: 434-529-6457

FAX: 434-529-6458

jpb8u@icloud.com

Key Words: SARS-CoV-2, microRNA, gene expression, pathogenesis, therapy

Abstract:

The SARS-CoV-2 virus is presently responsible for sickening millions of persons worldwide who develop variable symptoms ranging from mild/none to severe adult respiratory distress syndrome (ARDS) with multiple organ failure and death.

The genome of SARS-CoV-2 is a ~30 kilobase positive RNA strand that is transcribed inside infected cells to produce a polyprotein that is then hydrolyzed into multiple viral proteins with variable functions.

miRNA’s are small molecules that are a component of epigenetic systems and post-transcriptionally regulate gene expression. Using the miRDB algorithm (1) for predicting miRNA gene targets (miRDB.org), I examined the mature miRNA sequences of the SARS-CoV-2 genome reported by Sacar and Adan (2) in terms of strong predicted interactions (Target Prediction by miRDB = 90-100) with human genes. The potentially regulated human genes were then analyzed for gene ontology family clustering using Panther (pantherdb.org).

I found extensive involvement of human Gene Ontology families involved in molecular and biological processes that are regulated by miRNA’s present on the SARS-CoV-2 genome. miRDB predicted that one SARS-CoV-2 miRNA strongly regulated 15 human protocadherin genes, implying that if expressed, it could alter human adult brain function. miRDB predicted that another SARS-CoV-2 miRNA strongly regulated >600 human genes.

Blockade of SARS-CoV-2 miRNA’s (“miRNA sponge”, (3)) is one potential therapeutic approach. In addition, heterogeneity of viral miRNA presence and suppression of human gene expression across individuals, potentially monitored by their T-lymphocytes (4), may provide insights into the variable clinical courses of infection.

Introduction

We are presently suffering the consequences of rapid person-person spread of highly contagious infection with the SARS-CoV-2 virus that is believed to have recently migrated from mammals to humans (5-16). This virus uses ACE2 protein as a cellular receptor (11) to bind to vulnerable cells; and following viral genomic insertion, transcribes intracellularly its ~30 kilobase RNA into a polyprotein that is cleaved to multiple viral proteins (17). The primary target of SARS-CoV-2 virus is the respiratory tree, and the major symptoms are due to viral pneumonia, decreasing lung compliance and hypoxia. Most persons infected with SARS-CoV-2 virus develop none-mild-moderate COVID-19 symptoms and experience an uneventful recovery. A minority develop ARDS, require ventilator support and can die from refractory hypoxia and multiple organ failure. These individuals may die as a result of a “cytokine storm” of inflammatory cytokines (18-34).

Specific antiviral treatments are presently in clinical trials, and potential vaccines are being developed. Therapies that interrupt specific viral pathogenesis mechanisms are being sought. One area of investigation involves the microRNA (miRNA) responses of the host human cells/organs altering translation of viral RNA, or miRNA’s endogenous to the viral genome that could down-regulate human genes in vulnerable cells (35-37).

Recently Sacar and Adan (2) published a preprint on the BioRxiv server describing a computational analysis of a SARS-CoV-2 genome deposited in NCBI, as to the presence of a) miRNA hairpin and mature sequences that could be processed by mammalian miRNA synthesis systems, and b) human miRNA’s that could interact with and regulate viral genes. The authors also provided an analysis using the Panther algorithm (pantherdb.org) of the protein processes and pathways of human genes potentially altered by viral miRNA’s.

I have revisited their dataset of viral genome mature miRNA sequences (2) and used the very recently updated miRDB algorithm (1) (miRDB.org) to assess human genes likely to be strongly regulated by viral miRNA’s. I find extensive interactions of viral genomic miRNA’s with multiple human genes of differing gene ontology (GO) groups, and in particular, one viral miRNA possessing strong interactions with multiple protocadherin genes involved in neuron-neuron interactions (38-45).

Materials and Methods

Mature miRNA sequences found by Sacar and Adan (2) in the SARS-CoV-2 genome and reported by them in Supplemental Table 1 were individually submitted to miRDB (1), which then listed human genes predicted to interact with each miRNA. miRDB reported interactions ranked by “Target Score” ranging from 50-100. I selected only those genes with Target Scores of 90-100 and submitted a composite list to Panther for gene ontology analysis.

Results

Table 1. Human-like miRNA’s in SARS-CoV-2 Genome (2), Ranked by Interaction With Human Genes (miRDB)

Accession Mature miRNA Sequence # Genes With Target Score 90-100 (miRDB)

1

AACAAAAGCUAGCUCUUGGAGGU

666

2

GUUUUCAUCAACUUUUAAC

323

3

UUGAUAAAGUACUUAAUGAGAAG

158

4

CAUGUAUUCUGUUAUGCUUACUA

111

5

UUAUUAGUGAUAUGUACG

90

6

UAUGUACCACUAAAGUCUGCUAC

66

7

GAGUACAGACACUGGUG

60

8

UGCUGAUUAUUCUGUCCU

49

9

UCUUAUCAGAGGCACGU

47

10

AUUUAGGUGGUGCUGUCUGU

43

11

CCUGUGUUGUGGCAGAUGCUGUC

43

12

UUGUGGCAGAUGCUGUCAUAAAA

43

13

UGCUCUGCCUAUACAGUUGAACU

32

14

AUAGAUUAUGUACCACUAAAGUC

26

15

GUACCACUAAAGUCUGCUACGUG

24

16

UCAUGGGACACUUCGCAUGGUGG

23

17

AAGUACUUAAUGAGAAGUGCUCU

23

18

AUAAGCUCAUGGGACACUUCGCA

20

19

CAACCUAUACUGUUACUAGAUCA

18

20

CAGUUACUUCACUUCAGA

15

21

UGGUGGACAGCCUUUGUU

14

22

CUGCCUAUACAGUUGAACUCGGU

13

23

AGCUAGCUCUUGGAGGUUCCGUG

5

24

UCCGUGGCUAUAAAGAUAACAGA

5

25

ACGUUGCAAUUUAGGUGGUGC

0

Table 1 lists mature viral genomic miRNA sequences from Supplemental Table 1 of Sacar and Adan (2), along with numbers of human genes predicted by miRDB to have strong interactions with each viral miRNA. The miRNA’s are ranked by number of human genes with strong interactions (“Target Score” of 90-100).

Figures 1 and 2 are bar charts that show the gene ontology distributions of Molecular Processes (Figure 1)

Figure 1.
Bar chart showing Gene Ontology (GO; Molecular Function) of Human Genes that interact with SARS-CoV-2 genome miRNA’s (26) based on Target Predictions of 90-100 from miRDB (31). Data from Panther (pantherdb.org)

and Biological Processes (Figure 2)

Figure 2.
Bar chart showing Gene Ontology (GO; Biological Process) of Human Genes that interact with SARS-CoV-2 genome miRNA’s (26) based on Target Predictions of 90-100 from miRDB (31). Data from Panther (pantherdb.org)

derived from the Panther analyses (pantherdb.org). Among Molecular Processes (Figure 1), two families accounted for the majority: binding (GO:0005488) and catalytic activity (GO:0003824). Among Cell Processes, three groups were dominant: biological regulation (GO:0065007), cellular process (GO:0009987) and metabolic process (GO:0008152).

One particular predicted viral miRNA, AUUUAGGUGGUGCUGUCUGU (Accession 10, Table 1), interacted strongly (“Target Score” = 99) with 15 human protocadherin genes (38-45). Should this viral miRNA be expressed during SARS-CoV-2 infection, then one could imagine disrupted neuronal connections and functions arising in neural tissues of adults.

Discussion

SARS-CoV-2 virus likely uses many viral genetic “tricks” to achieve its high infectivity rate that has resulted in rapid appearance of a worldwide viral pandemic. It remains unclear why there appears to be such a heterogenous clinical response to viral infection, with some (generally younger) patients showing no or mild COVID-19 symptoms, and others (generally older and/or with underlying medical illnesses) developing more severe COVID-19 symptoms, including ARDS and death (16).

Sacar and Adan (2) provided data that the SARS-CoV-2 genome contains hairpin and mature miRNA sequences that could regulate human genes. In this paper, I provide additional data using a most modern miRNA-gene targeting algorithm (miRDB (1)) to show that strongly interacting viral miRNA’s could regulate multiple intracellular processes, including those mediated by protocadherin in human brain.

The current paper is at best a preliminary report that hopefully will stimulate others to seek additional viral miRNA-human gene interactions. Specifically, it would be desirable to determine gene expression at varying time points after infection of human cells with SARS-CoV-2 virus, and to monitor expression of viral miRNA’s during infections. miRNA sponges (3) could be used to adsorb problematic SARS-CoV-2 miRNA’s, if they are expressed. Since SARS-CoV-2 virus can infect readily accessible T-lymphocytes (4), this cell population is easily studied and could be used in the above experiments.

Acknowledgements

Supported by Neurodegeneration Therapeutics, Inc. The author reports no conflicts of interest. No human subjects research took place. No animals were used in this study.

Author Contributions

The primary author (JPB) carried out all data analysis and manuscript preparation.

References (limited)

1. Y. Chen and X. Wang: miRDB: an online database for prediction of functional microRNA targets. Nucleic Acids Res, 48(D1), D127-D131 (2020) doi:10.1093/nar/gkz757

2. M. D. Saçar Demirci and A. Adan: (2020) doi:10.1101/2020.03.15.992438

3. J. Kluiver, I. Slezak-Prochazka, K. Smigielska-Czepiel, N. Halsema, B. J. Kroesen and A. van den Berg: Generation of miRNA sponge constructs. Methods, 58(2), 113-7 (2012) doi:10.1016/j.ymeth.2012.07.019

4. X. Wang, W. Xu, G. Hu, S. Xia, Z. Sun, Z. Liu, Y. Xie, R. Zhang, S. Jiang and L. Lu: SARS-CoV-2 infects T lymphocytes through its spike protein-mediated membrane fusion. Cell Mol Immunol (2020) doi:10.1038/s41423-020-0424-9

5. Y. Yan, Y. Yang, F. Wang, H. Ren, S. Zhang, X. Shi, X. Yu and K. Dong: Clinical characteristics and outcomes of patients with severe covid-19 with diabetes. BMJ Open Diabetes Res Care, 8(1) (2020) doi:10.1136/bmjdrc-2020-001343

6. S. Aggarwal, N. Garcia-Telles, G. Aggarwal, C. Lavie, G. Lippi and B. M. Henry: Clinical features, laboratory characteristics, and outcomes of patients hospitalized with coronavirus disease 2019 (COVID-19): Early report from the United States. Diagnosis (Berl), 7(2), 91-96 (2020) doi:10.1515/dx-2020-0046

7. F. Alberici, E. Delbarba, C. Manenti, L. Econimo, F. Valerio, A. Pola, C. Maffei, S. Possenti, S. Piva, N. Latronico, E. Foca, F. Castelli, P. Gaggia, E. Movilli, S. Bove, F. Malberti, M. Farina, M. Bracchi, E. M. Costantino, N. Bossini, M. Gaggiotti, F. Scolari and C. T. F. Brescia Renal: Management Of Patients On Dialysis And With Kidney Transplant During SARS-COV-2 (COVID-19) Pandemic In Brescia, Italy. Kidney Int Rep (2020) doi:10.1016/j.ekir.2020.04.001

8. H. Ali, A. Daoud, M. M. Mohamed, S. A. Salim, L. Yessayan, J. Baharani, A. Murtaza, V. Rao and K. M. Soliman: Survival rate in acute kidney injury superimposed COVID-19 patients: a systematic review and meta-analysis. Ren Fail, 42(1), 393-397 (2020) doi:10.1080/0886022X.2020.1756323

9. A. A. Dawood: Mutated COVID-19, May Foretells Mankind in a Great Risk in the Future. New Microbes New Infect, 100673 (2020) doi:10.1016/j.nmni.2020.100673

10. J. M. Abduljalil and B. M. Abduljalil: Epidemiology, genome, and clinical features of the pandemic SARS-CoV-2: a recent view. New Microbes New Infect, 35, 100672 (2020) doi:10.1016/j.nmni.2020.100672

11. I. Astuti and Ysrafil: Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2): An overview of viral structure and host response. Diabetes Metab Syndr, 14(4), 407-412 (2020) doi:10.1016/j.dsx.2020.04.020

12. Y. Cao, X. Liu, L. Xiong and K. Cai: Imaging and clinical features of patients with 2019 novel coronavirus SARS-CoV-2: A systematic review and meta-analysis. J Med Virol (2020) doi:10.1002/jmv.25822

13. C. Chakraborty, A. R. Sharma, G. Sharma, M. Bhattacharya and S. S. Lee: SARS-CoV-2 causing pneumonia-associated respiratory disorder (COVID-19): diagnostic and proposed therapeutic options. Eur Rev Med Pharmacol Sci, 24(7), 4016-4026 (2020) doi:10.26355/eurrev_202004_20871

14. A. L. Giwa, A. Desai and A. Duca: Novel 2019 coronavirus SARS-CoV-2 (COVID-19): an overview for emergency clinicians. Pediatr Emerg Med Pract, 17(5), 1-24 (2020)

15. A. Kazory, C. Ronco and P. A. McCullough: SARS-CoV-2 (COVID-19) and intravascular volume management strategies in the critically ill. Proc (Bayl Univ Med Cent), 0(0), 1-6 (2020) doi:10.1080/08998280.2020.1754700

16. G. Chen, D. Wu, W. Guo, Y. Cao, D. Huang, H. Wang, T. Wang, X. Zhang, H. Chen, H. Yu, X. Zhang, M. Zhang, S. Wu, J. Song, T. Chen, M. Han, S. Li, X. Luo, J. Zhao and Q. Ning: Clinical and immunological features of severe and moderate coronavirus disease 2019. J Clin Invest (2020) doi:10.1172/JCI137244

17. C. Li, Y. Yang and L. Ren: Genetic evolution analysis of 2019 novel coronavirus and coronavirus from other species. Infect Genet Evol, 82, 104285 (2020) doi:10.1016/j.meegid.2020.104285

18. R. J. Jose and A. Manuel: COVID-19 cytokine storm: the interplay between inflammation and coagulation. Lancet Respir Med (2020) doi:10.1016/S2213-2600(20)30216-2

19. M. F. Konig, M. A. Powell, V. Staedtke, R. Y. Bai, D. L. Thomas, N. M. Fischer, S. Huq, A. M. Khalafallah, A. Koenecke, R. Xiong, B. Mensh, N. Papadopoulos, K. W. Kinzler, B. Vogelstein, J. T. Vogelstein, S. Athey, S. Zhou and C. Bettegowda: Preventing cytokine storm syndrome in COVID-19 using alpha-1 adrenergic receptor antagonists. J Clin Invest (2020) doi:10.1172/JCI139642

20. S. F. Assimakopoulos and M. Marangos: N-acetyl-cysteine may prevent COVID-19-associated cytokine storm and acute respiratory distress syndrome. Med Hypotheses, 140, 109778 (2020) doi:10.1016/j.mehy.2020.109778

21. B. Lipworth, R. Chan, S. Lipworth and C. RuiWen Kuo: Weathering the Cytokine Storm in Susceptible Patients with Severe SARS-CoV-2 Infection. J Allergy Clin Immunol Pract (2020) doi:10.1016/j.jaip.2020.04.014

22. M. Zhao: Cytokine storm and immunomodulatory therapy in COVID-19: Role of chloroquine and anti-IL-6 monoclonal antibodies. Int J Antimicrob Agents, 105982 (2020) doi:10.1016/j.ijantimicag.2020.105982

23. L. A. Henderson, S. W. Canna, G. S. Schulert, S. Volpi, P. Y. Lee, K. F. Kernan, R. Caricchio, S. Mahmud, M. M. Hazen, O. Halyabar, K. J. Hoyt, J. Han, A. A. Grom, M. Gattorno, A. Ravelli, F. de Benedetti, E. M. Behrens, R. Q. Cron and P. A. Nigrovic: On the alert for cytokine storm: Immunopathology in COVID-19. Arthritis Rheumatol (2020) doi:10.1002/art.41285

24. V. Q. Chau, E. Oliveros, K. Mahmood, A. Singhvi, A. Lala, N. Moss, U. Gidwani, D. M. Mancini, S. P. Pinney and A. Parikh: The Imperfect Cytokine Storm: Severe COVID-19 with ARDS in Patient on Durable LVAD Support. JACC Case Rep (2020) doi:10.1016/j.jaccas.2020.04.001

25. Y. Zhang, L. Yu, L. Tang, M. Zhu, Y. Jin, Z. Wang and L. Li: A Promising Anti-Cytokine-Storm Targeted Therapy for COVID-19: The Artificial-Liver Blood-Purification System. Engineering (Beijing) (2020) doi:10.1016/j.eng.2020.03.006

26. B. Liu, M. Li, Z. Zhou, X. Guan and Y. Xiang: Can we use interleukin-6 (IL-6) blockade for coronavirus disease 2019 (COVID-19)-induced cytokine release syndrome (CRS)? J Autoimmun, 102452 (2020) doi:10.1016/j.jaut.2020.102452

27. K. K. Gupta, M. A. Khan and S. K. Singh: Constitutive Inflammatory Cytokine Storm: A Major Threat to Human Health. J Interferon Cytokine Res, 40(1), 19-23 (2020) doi:10.1089/jir.2019.0085

28. J. Ma, P. Xia, Y. Zhou, Z. Liu, X. Zhou, J. Wang, T. Li, X. Yan, L. Chen, S. Zhang, Y. Qin and X. Li: Potential effect of blood purification therapy in reducing cytokine storm as a late complication of critically ill COVID-19. Clin Immunol, 214, 108408 (2020) doi:10.1016/j.clim.2020.108408

29. P. Mehta, D. F. McAuley, M. Brown, E. Sanchez, R. S. Tattersall, J. J. Manson and U. K. Hlh Across Speciality Collaboration: COVID-19: consider cytokine storm syndromes and immunosuppression. Lancet, 395(10229), 1033-1034 (2020) doi:10.1016/S0140-6736(20)30628-0

30. N. Vaninov: In the eye of the COVID-19 cytokine storm. Nat Rev Immunol (2020) doi:10.1038/s41577-020-0305-6

31. T. L. Wampler Muskardin: IV anakinra for macrophage activation syndrome may hold lessons for treatment of cytokine storm in the setting of COVID19. ACR Open Rheumatol (2020) doi:10.1002/acr2.11140

32. D. Wu and X. O. Yang: TH17 responses in cytokine storm of COVID-19: An emerging target of JAK2 inhibitor Fedratinib. J Microbiol Immunol Infect (2020) doi:10.1016/j.jmii.2020.03.005

33. Q. Ye, B. Wang and J. Mao: The pathogenesis and treatment of the `Cytokine Storm’ in COVID-19. J Infect (2020) doi:10.1016/j.jinf.2020.03.037

34. C. Zhang, Z. Wu, J. W. Li, H. Zhao and G. Q. Wang: The cytokine release syndrome (CRS) of severe COVID-19 and Interleukin-6 receptor (IL-6R) antagonist Tocilizumab may be the key to reduce the mortality. Int J Antimicrob Agents, 105954 (2020) doi:10.1016/j.ijantimicag.2020.105954

35. M. Correia de Sousa, M. Gjorgjieva, D. Dolicka, C. Sobolewski and M. Foti: Deciphering miRNAs’ Action through miRNA Editing. Int J Mol Sci, 20(24) (2019) doi:10.3390/ijms20246249

36. J. Ye, M. Xu, X. Tian, S. Cai and S. Zeng: Research advances in the detection of miRNA. J Pharm Anal, 9(4), 217-226 (2019) doi:10.1016/j.jpha.2019.05.004

37. M. Schafer and C. Ciaudo: Prediction of the miRNA interactome – Established methods and upcoming perspectives. Comput Struct Biotechnol J, 18, 548-557 (2020) doi:10.1016/j.csbj.2020.02.019

38. T. Yagi: Diversity of the cadherin-related neuronal receptor/protocadherin family and possible DNA rearrangement in the brain. Genes Cells, 8(1), 1-8 (2003) doi:10.1046/j.1365-2443.2003.00614.x

39. T. Hirayama and T. Yagi: The role and expression of the protocadherin-alpha clusters in the CNS. Curr Opin Neurobiol, 16(3), 336-42 (2006) doi:10.1016/j.conb.2006.05.003

40. S. Y. Kim, H. S. Chung, W. Sun and H. Kim: Spatiotemporal expression pattern of non-clustered protocadherin family members in the developing rat brain. Neuroscience, 147(4), 996-1021 (2007) doi:10.1016/j.neuroscience.2007.03.052

41. C. Zou, W. Huang, G. Ying and Q. Wu: Sequence analysis and expression mapping of the rat clustered protocadherin gene repertoires. Neuroscience, 144(2), 579-603 (2007) doi:10.1016/j.neuroscience.2006.10.011

42. H. Morishita and T. Yagi: Protocadherin family: diversity, structure, and function. Curr Opin Cell Biol, 19(5), 584-92 (2007) doi:10.1016/j.ceb.2007.09.006

43. T. Hirabayashi and T. Yagi: Protocadherins in neurological diseases. Adv Neurobiol, 8, 293-314 (2014) doi:10.1007/978-1-4614-8090-7_13

44. S. Toyoda, M. Kawaguchi, T. Kobayashi, E. Tarusawa, T. Toyama, M. Okano, M. Oda, H. Nakauchi, Y. Yoshimura, M. Sanbo, M. Hirabayashi, T. Hirayama, T. Hirabayashi and T. Yagi: Developmental epigenetic modification regulates stochastic expression of clustered protocadherin genes, generating single neuron diversity. Neuron, 82(1), 94-108 (2014) doi:10.1016/j.neuron.2014.02.005

45. A. B. Keeler, M. J. Molumby and J. A. Weiner: Protocadherins branch out: Multiple roles in dendrite development. Cell Adh Migr, 9(3), 214-26 (2015) doi:10.1080/19336918.2014.1000069